2. Restriction Enzymes

Learning outcomes
  • I can describe the function of restriction enzymes.
  • I can explain how restriction enzymes cut DNA.
  • I can identify recognition sequences in DNA.
  • I can explain why restriction enzymes are important in genetic engineering.
  • I can interpret simple diagrams involving restriction enzymes.

Introduction

DNA contains the genetic instructions used by living organisms. To study or modify these instructions, scientists often need to cut DNA at precise locations. This can be done using special proteins called restriction enzymes.

Restriction enzymes act like molecular scissors. However, they do not cut DNA randomly. Each restriction enzyme recognises a particular sequence of DNA bases and cuts the DNA at or near that sequence. This precision allows scientists to remove genes, open plasmids, compare DNA samples, and construct new combinations of DNA.

Restriction enzymes occur naturally in bacteria. Scientists have adapted them into some of the most important tools used in modern biotechnology and genetic engineering.

https://images.openai.com/static-rsc-4/4Mq8Rn3nccYqi1Lrr7qnafi_29hItZ7Q0uEYYWz3Wclzs_nzu0EwT25Wy-aF12Ab-_Pogp9iGXYnpTBO2mhc0plNXGrbOJ0DxSyc4HUO1DLqjxCVZEmsBS8g6A-G5Q3uGSe_84zRYLla5fYEoAxZ3Zc7PtH1OgOO4YOJNFztax1EGZ1LRwk51OVRLVUzHaAn?purpose=fullsize
 
https://images.openai.com/static-rsc-4/xNxg_CgcPVJAEKNOGx3zxY0MRXRDj12-3K8_Auj5J1qtlFoAsH1yP--Tj45Z6ZZft6W66h5mLwbSJ8UmRug5Wdi5Lb2LuXY9D2pVecTHq6AmAYZdgGRYOiV3wJJrWwNhuKXmcjzbAWx53rU3DIGxx01KkBuAK9cCLpOTezYBAyCMDiROSoKj_cNH4OHJ7SHr?purpose=fullsize
 
https://images.openai.com/static-rsc-4/fXZxy3D3Q-QUt7AIdicomHSOhm66kcScxvjoFUPIHxDoBNgOuFeWdbDgOJst6zyvNgPHxpGnJffZbTiHVSjc52O0Vt3kUT1Igb3UFKARqesGa4G5udTHWSjlnYjy-ynJgJ7AwpSdG6z5VjzMe-YMwJeul_4elrH0Fd3xhNIk318-jQx30oAjvcvo8119bco9?purpose=fullsize
 
5

What Are Restriction Enzymes?

A restriction enzyme is a protein that recognises a specific DNA base sequence and cuts the DNA backbone at a particular location.

Restriction enzymes are more precisely called restriction endonucleases:

  • Restriction refers to their ability to restrict or stop viral infections in bacteria.
  • Endo means within.
  • Nuclease means an enzyme that cuts nucleic acids such as DNA.

This means that a restriction endonuclease cuts DNA at locations within a DNA molecule.

Each restriction enzyme has its own recognition sequence. Therefore, different restriction enzymes cut DNA at different locations.

For example:

  • EcoRI recognises GAATTC.
  • BamHI recognises GGATCC.
  • HindIII recognises AAGCTT.
  • SmaI recognises CCCGGG.

Restriction enzymes are usually named after the bacteria in which they were discovered. For example, EcoRI was originally isolated from the bacterium Escherichia coli.

The Natural Function of Restriction Enzymes

Restriction enzymes form part of the defence system of many bacteria. Viruses that infect bacteria are called bacteriophages, or phages. When a bacteriophage infects a bacterial cell, it injects its DNA into the cell.

The bacterium’s restriction enzymes can recognise particular sequences in the invading viral DNA. They cut the viral DNA into smaller fragments, preventing the virus from using the bacterial cell to reproduce.

The general process is:

  1. Viral DNA enters a bacterial cell.
  2. A restriction enzyme binds to its recognition sequence.
  3. The enzyme cuts the viral DNA.
  4. The damaged viral DNA can no longer function normally.
  5. The bacterial cell may survive the infection.

The bacterium must also protect its own DNA from being cut. It usually does this by adding small chemical groups called methyl groups to its own recognition sequences. This process is called DNA methylation. The restriction enzyme can distinguish the protected bacterial DNA from unprotected foreign DNA.

Together, restriction enzymes and DNA methylation form a restriction–modification system.

Recognition Sequences

A recognition sequence, also called a restriction site, is the particular sequence of DNA bases recognised by a restriction enzyme.

Recognition sequences are usually short, often containing four to eight base pairs. Because these sequences occur at particular locations, a restriction enzyme produces a predictable set of DNA fragments.

For example, EcoRI recognises the following sequence:

 
5′–G A A T T C–3′
3′–C T T A A G–5′
 

The two DNA strands are complementary:

  • G pairs with C.
  • A pairs with T.
  • T pairs with A.
  • C pairs with G.

When identifying a recognition sequence, remember that DNA strands run in opposite directions. One strand runs from 5′ to 3′, while the other runs from 3′ to 5′.

Palindromic Recognition Sequences

Many restriction enzymes recognise palindromic sequences. A DNA palindrome reads the same in the 5′ to 3′ direction on both complementary strands.

Consider the EcoRI recognition sequence:

 
Top strand:       5′–G A A T T C–3′
Bottom strand:    3′–C T T A A G–5′
 

If the bottom strand is read in its own 5′ to 3′ direction, it also reads GAATTC:

 
5′–G A A T T C–3′
 

Therefore, GAATTC is a palindromic recognition sequence.

This does not mean that the sequence reads the same forwards and backwards on a single written strand. It means that both complementary strands have the same sequence when each is read from 5′ to 3′.

Examples of Recognition Sequences

Restriction enzyme Recognition sequence Source organism
EcoRI GAATTC Escherichia coli
BamHI GGATCC Bacillus amyloliquefaciens
HindIII AAGCTT Haemophilus influenzae
SmaI CCCGGG Serratia marcescens

How Restriction Enzymes Cut DNA

The sides of a DNA molecule contain alternating sugar and phosphate groups. Together, they form the sugar–phosphate backbone. The bases point towards the centre of the molecule and form complementary base pairs.

A restriction enzyme cuts the strong phosphodiester bonds in the sugar–phosphate backbone. It cuts both strands of the DNA at particular positions within or near its recognition sequence.

The process can be summarised as follows:

  1. The restriction enzyme moves along or interacts with the DNA molecule.
  2. It encounters its specific recognition sequence.
  3. The enzyme binds to the DNA at the recognition site.
  4. It cuts the sugar–phosphate backbone of both strands.
  5. The DNA separates into fragments.

The sequence of bases is not destroyed. Instead, the DNA backbone is broken at specific points.

EcoRI: A Worked Example

EcoRI recognises GAATTC and makes a staggered cut between G and A on each strand.

 
Before cutting:

5′–G A A T T C–3′
3′–C T T A A G–5′
 

The cutting positions can be shown using arrows:

 
5′–G↓A A T T C–3′
3′–C T T A A↑G–5′
 

After cutting:

 
5′–G             A A T T C–3′
3′–C T T A A             G–5′
 

The staggered cut leaves short, exposed sections of unpaired bases:

 
AATT
TTAA
 

These exposed sections are called sticky ends or cohesive ends.

https://images.openai.com/static-rsc-4/4Mq8Rn3nccYqi1Lrr7qnafi_29hItZ7Q0uEYYWz3Wclzs_nzu0EwT25Wy-aF12Ab-_Pogp9iGXYnpTBO2mhc0plNXGrbOJ0DxSyc4HUO1DLqjxCVZEmsBS8g6A-G5Q3uGSe_84zRYLla5fYEoAxZ3Zc7PtH1OgOO4YOJNFztax1EGZ1LRwk51OVRLVUzHaAn?purpose=fullsize
 
https://images.openai.com/static-rsc-4/3WZxam-ZLyQ83FezkT0EEnjOPt8FHdsfvvirnTmR2-RFZB7f3v0MNsGKj-FKtFkzX10Ih-hDj5FSl1HMIHXxh8kEQM-Y5OFl5xG1cpoy05vkVYCjObGLWys3g_xQvZi6V3T1E0RNjNxorEmVGPzh5bL0VuvzRlWeESE22GjEK1NHGhGmq1hm6FAoSnPF2i8A?purpose=fullsize
 
https://images.openai.com/static-rsc-4/E4piyg-Fi6DwWBnIRW7mXnm1a3VkTD_tv7c0SHCFEycwHq0ksMSV87qSNHMoTkrB5Am2j7ngHwhKl57VhR3Bu7XRinyVMF_SkaqYg7Pd-3r4qmKyAZfGfKwVYBbZhssL2fMcDgynJbTF1k3IcUx8xqwiCuEX5W6BuWxIxOriVIj-hkG9Grog_0u3_GP6XmSm?purpose=fullsize
 
5

Sticky Ends

Sticky ends are short, single-stranded sections of DNA produced by staggered cuts.

They are described as “sticky” because their exposed bases can form hydrogen bonds with complementary bases on another DNA fragment.

For example:

 
AATT
 

can pair with:

 
TTAA
 

Sticky ends follow the normal complementary base-pairing rules:

  • A pairs with T.
  • C pairs with G.

If two DNA molecules are cut with the same restriction enzyme, they usually have matching sticky ends. The matching ends can temporarily join through complementary base pairing.

This ability is particularly useful in genetic engineering because it allows DNA from different sources to be combined.

Blunt Ends

Some restriction enzymes cut both DNA strands at the same position. This produces blunt ends, which have no single-stranded overhangs.

For example, SmaI recognises CCCGGG:

 
5′–C C C↓G G G–3′
3′–G G G↑C C C–5′
 

After cutting:

 
5′–C C C       G G G–3′
3′–G G G       C C C–5′
 

Blunt-ended DNA fragments can be joined, but they do not have complementary overhangs that help hold them together. As a result, joining blunt ends is generally less efficient than joining matching sticky ends.

Comparing Sticky and Blunt Ends

Feature Sticky ends Blunt ends
Type of cut Staggered Straight
Exposed bases Present Absent
Complementary pairing Can occur Cannot occur before joining
Ease of joining Usually easier Usually more difficult
Example enzyme EcoRI SmaI

Cutting DNA into Fragments

A restriction enzyme cuts DNA every time its recognition sequence occurs. Therefore, the number and positions of the recognition sites determine the DNA fragments produced.

For a linear DNA molecule:

  • One recognition site produces two fragments.
  • Two recognition sites produce three fragments.
  • Three recognition sites produce four fragments.

For linear DNA:

Number of fragments = number of cuts + 1

For a circular DNA molecule, such as a bacterial plasmid:

  • One recognition site opens the circle and produces one linear fragment.
  • Two recognition sites produce two fragments.
  • Three recognition sites produce three fragments.

For circular DNA:

Number of fragments = number of cuts

Worked Example

Examine the following linear DNA sequence:

 
AAGCTAGAATTCCGTAGAATTCGCA
 

EcoRI recognises GAATTC.

The recognition sites can be identified as follows:

 
AAGCTA GAATTC CGTA GAATTC GCA
 

There are two EcoRI recognition sites.

Because the DNA is linear:

 
Number of fragments = 2 cuts + 1
Number of fragments = 3
 

EcoRI would cut this DNA molecule into three fragments.

Restriction Enzymes in Genetic Engineering

Genetic engineering is the deliberate modification of an organism’s DNA. It may involve removing a gene, copying a gene, changing a gene, or transferring a gene from one organism to another.

Restriction enzymes are important because they allow scientists to cut DNA at precise and predictable locations.

A common genetic-engineering process involves placing a useful gene into a bacterial plasmid. A plasmid is a small, circular DNA molecule found naturally in many bacteria.

The process includes the following steps:

  1. Scientists identify a gene with a useful function.
  2. A restriction enzyme is used to cut the gene from a DNA molecule.
  3. The same restriction enzyme is used to cut open a bacterial plasmid.
  4. The gene and plasmid have complementary sticky ends.
  5. The matching sticky ends join through complementary base pairing.
  6. DNA ligase seals the sugar–phosphate backbone.
  7. The resulting plasmid contains DNA from two different sources.
  8. The recombinant plasmid is introduced into a bacterial cell.
  9. The bacterium copies the plasmid as it grows and reproduces.
  10. The bacterium may use the inserted gene to produce a useful protein.

DNA formed by combining genetic material from different sources is called recombinant DNA.

https://images.openai.com/static-rsc-4/veQzUoYLxshAr8rFuL2iaeGo8WcchM-4QyimH8HgnmkNCCR49T1Z8_BN-qnPyaXe5pqL191B26BFkHVFPf00hFP-PVUSx0ZjPthHdgSn3wmb3KoFPZ5_BvKEh-J881S7PTrRm2oFdKYrLjTN5PjFMIRXWYoo1kTcOIhbpoP0PFaAKnXvLCT9T5-w8T1yy7Iy?purpose=fullsize
 
https://images.openai.com/static-rsc-4/9beL9hCPG5OxHWvtJCWoHiAix5LXOvZ0ZpijfgcBDDxaxXWncuDAeYcq2cuI8YRYTBmLJFVTxQkTdU6AuFwBRZo4KyD2-6-ebkWptuMFGwSZ-Xfr42ghp71nkxEeI5gborkYWPp5llH5J6T7m1dXdIJ0L07Kn9HRlInzOBik3PbsHqmTrsxSbRldl2PFOj_s?purpose=fullsize
 
https://images.openai.com/static-rsc-4/dCa2gzQZ5fk_vf3t4ojUPDS669sXpsrp3jWvpAgD-O1QCkTbv5IYLyxrlRZVQXNoIu36RAmqim2xX8bkrymAGAsLNPbtbncDOTPOdNPQE1-yotNkQEO5BxhyBwPslrKjQ0UDyckbnXvNYSHAmyr7LNSrl4VMP8fgS7sgEL1wqCXi3RXe8Xx6iSjqKBBCy-Yn?purpose=fullsize
 
6

Why the Same Restriction Enzyme Is Used

Scientists commonly cut the desired gene and the plasmid with the same restriction enzyme.

This is important because the same enzyme produces matching ends on both DNA molecules. If EcoRI is used to cut both pieces of DNA, both will have complementary AATT sticky ends.

 
Human gene fragment:       AATT
                              ||||
Opened plasmid end:        TTAA
 

The complementary bases attract one another and hold the two DNA pieces together.

Using two enzymes that produce incompatible sticky ends would prevent the DNA fragments from pairing correctly.

The Role of DNA Ligase

Restriction enzymes cut DNA, but they do not permanently join DNA fragments. A different enzyme, called DNA ligase, completes this step.

DNA ligase:

  • Joins adjacent nucleotides.
  • Repairs breaks in the sugar–phosphate backbone.
  • Forms phosphodiester bonds between DNA fragments.
  • Makes the recombinant DNA molecule stable and continuous.

A useful comparison is:

  • Restriction enzymes are molecular scissors.
  • DNA ligase is molecular glue.

However, DNA ligase does not simply stick any DNA pieces together. The fragments must first be positioned so that their ends can be joined.

Applications of Restriction Enzymes

Restriction enzymes have many uses in biotechnology, medicine, agriculture, and scientific research.

Producing Human Insulin

The human insulin gene can be inserted into a bacterial plasmid. Modified bacteria then produce human insulin, which can be collected and purified for the treatment of diabetes.

Producing Other Medicines

Genetically engineered cells can produce useful proteins, including:

  • Human growth hormone.
  • Blood-clotting proteins.
  • Some vaccine components.
  • Enzymes used in medical treatments.

Creating Genetically Modified Organisms

Restriction enzymes can help scientists insert useful genes into plants or microorganisms. The inserted genes may provide characteristics such as:

  • Resistance to certain pests.
  • Improved nutritional content.
  • Tolerance of environmental conditions.
  • Production of medically useful substances.

Analysing DNA

Restriction enzymes can cut DNA into fragments of different lengths. The fragments can then be separated using gel electrophoresis.

Differences in fragment patterns can help scientists:

  • Compare DNA samples.
  • Investigate genetic variation.
  • Study particular genes.
  • Construct maps showing restriction sites in DNA.

How to Interpret Restriction-Enzyme Diagrams

Restriction-enzyme diagrams often show recognition sequences, cutting positions, DNA fragments, sticky ends, plasmids, or inserted genes.

When interpreting a diagram, use the following steps.

Step 1: Identify the DNA Strands

Look for two complementary strands. Check the 5′ and 3′ labels because the strands run in opposite directions.

Step 2: Find the Recognition Sequence

Search for the exact sequence recognised by the restriction enzyme. The sequence may be highlighted, underlined, or placed inside brackets.

Step 3: Locate the Cutting Positions

Arrows, vertical lines, or gaps may show where the DNA backbone is cut.

For example:

 
5′–G↓AATTC–3′
3′–CTTAA↑G–5′
 

Step 4: Determine the Type of End

  • An uneven or staggered cut produces sticky ends.
  • A straight cut across both strands produces blunt ends.

Step 5: Examine the Exposed Bases

If sticky ends are present, identify their base sequences. Determine whether they are complementary to the sticky ends of another fragment.

Step 6: Follow the DNA Fragments

In a plasmid diagram, identify:

  • The plasmid.
  • The desired gene.
  • The restriction sites.
  • The position where the plasmid is opened.
  • The position where the gene is inserted.
  • The final recombinant plasmid.

Diagram Interpretation Example

A scientist cuts a gene and a plasmid with EcoRI.

 
Gene fragment:

5′–AATT CCGTAC–3′
     ||||
3′–    GGCATG TTAA–5′
 
 
Opened plasmid:

3′–TTAA                    –5′
5′–                    AATT–3′
 

The ends are compatible because AATT can pair with TTAA. The gene can fit into the opened plasmid. DNA ligase can then seal the remaining breaks.

If the gene and plasmid had non-complementary ends, they would not pair correctly.

Limitations and Challenges

Restriction enzymes are highly useful, but their use has some limitations.

  • A suitable recognition sequence must be present near the DNA that scientists want to cut.
  • The desired gene may contain the same recognition sequence, causing it to be cut internally.
  • Different enzymes may produce incompatible ends.
  • Cutting may create several DNA fragments that must be separated.
  • The inserted gene may enter a plasmid in the wrong orientation.
  • Restriction enzymes cut DNA but do not guarantee that the gene will function correctly inside a new cell.

Scientists must therefore select their restriction enzymes carefully.

Did You Know?

The names of restriction enzymes contain information about their bacterial source. In EcoRI:

  • E comes from the genus Escherichia.
  • co comes from the species coli.
  • R identifies the bacterial strain.
  • I shows that it was the first restriction enzyme identified from that strain.

More than one restriction enzyme may be discovered in the same type of bacterium, so Roman numerals such as I, II, and III help distinguish them.

Key Terms

  • Bacteriophage: A virus that infects a bacterial cell.
  • Blunt ends: DNA ends produced when both strands are cut at the same position, leaving no exposed single-stranded bases.
  • Complementary base pairing: The specific pairing of DNA bases in which A pairs with T and C pairs with G.
  • DNA fragment: A section of DNA produced when a larger DNA molecule is cut.
  • DNA ligase: An enzyme that joins DNA fragments by sealing breaks in the sugar–phosphate backbone.
  • DNA methylation: The addition of methyl groups to DNA, which can protect bacterial DNA from its own restriction enzymes.
  • Genetic engineering: The deliberate modification or combination of DNA to change an organism or produce a useful substance.
  • Phosphodiester bond: A strong chemical bond that connects nucleotides in the sugar–phosphate backbone of DNA.
  • Plasmid: A small, circular DNA molecule found in many bacteria and often used as a vector in genetic engineering.
  • Recognition sequence: The specific sequence of DNA bases recognised by a restriction enzyme.
  • Recombinant DNA: DNA constructed by joining genetic material from two or more different sources.
  • Restriction enzyme: An enzyme that recognises a particular DNA sequence and cuts the DNA at or near that sequence.
  • Restriction endonuclease: The scientific name for an enzyme that cuts DNA at specific sites within a DNA molecule.
  • Restriction site: Another name for the DNA recognition sequence at which a restriction enzyme cuts.
  • Sticky ends: Short, single-stranded DNA overhangs produced by a staggered cut.
  • Sugar–phosphate backbone: The alternating chain of sugar and phosphate groups forming the sides of a DNA molecule.
  • Vector: A DNA molecule, such as a plasmid, used to carry genetic material into a cell.

Key Takeaways

  • Restriction enzymes are proteins that cut DNA at specific recognition sequences.
  • Bacteria naturally use restriction enzymes to defend themselves against invading viral DNA.
  • Many recognition sequences are palindromic when both strands are read from 5′ to 3′.
  • Restriction enzymes cut phosphodiester bonds in the DNA backbone.
  • Staggered cuts produce sticky ends, while straight cuts produce blunt ends.
  • Matching sticky ends can join through complementary base pairing.
  • DNA ligase permanently seals the joined DNA fragments.
  • Restriction enzymes allow scientists to remove genes, open plasmids, produce recombinant DNA, and genetically engineer cells.
  • A restriction-enzyme diagram should be interpreted by identifying the recognition site, cutting positions, resulting ends, and possible complementary fragments.